Stem-loop sequence mtr-MIR2671i

AccessionMI0012038 (change log)
DescriptionMedicago truncatula miR2671i stem-loop
Gene family MIPF0000813; MIR2655
Stem-loop
   -                                   c    c a            g      c              g                     a    -                            c       a       -guu            c   acucuaauac 
5'  ucguuuugguuccuuaacuauuaaaaguuucguuu gguc c uaacuuauuuuu gguuuu uuuuggucccuuaa uauuagaaguuucguuuuggu ccuu aacuuauuuuuugguuucguuuuggucc uuaacuu uuuuuug    ucguuuuggucc uua          a
    ||||||||||||||||||||||||||||||||||| |||| | |||||||||||| |||||| |||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||| |||||||    |||||||||||| |||          u
3'  agcaaaaccagggaauugauaauuuucaaagcaaa ccag g auugaaugaaaa ccaaag aaaaccagggaauu auaauuuucaaagcaaaacca ggaa uugaaugaaaaaccaaagcaaaaccagg aauugag aggaagc    ggugaaaucagg aau          u
   a                                   a    a a            a      c              g                     -    a                            -       a       aguu            a   acaauccuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 4398878-4399235 [-]
intergenic
Database links

Mature sequence mtr-miR2671i

Accession MIMAT0013491
Sequence

21 - 

uuaaaaguuucguuucggucc

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).