Stem-loop sequence mtr-MIR2672

AccessionMI0012039 (change log)
DescriptionMedicago truncatula miR2672 stem-loop
Stem-loop
   ----gua      -----uuaauu                                  --gc      a 
5'        aagaua           agugguuaaucgaccaaguggguacuacauacuu    guaucu a
          ||||||           ||||||||||||||||||||||||||||||||||    |||||| u
3'        uucuau           ucaccaauuagcugguucaccuaugauguaugag    uauaga u
   gcaauug      uauauauauuu                                  aagu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 32832806-32832935 [+]
intergenic
Database links

Mature sequence mtr-miR2672

Accession MIMAT0013492
Sequence

21 - 

uuaaucgaccaaguggguacua

 - 42

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).