Stem-loop sequence mtr-MIR2673a

AccessionMI0012040 (change log)
DescriptionMedicago truncatula miR2673a stem-loop
Gene family MIPF0001017; MIR2673
Stem-loop
   gucu     ----uu   -  uc          ------------      -u    aauuuca     a  guuaguuuccauagcgacuucauuuugcauuugugaagcugaauugguccagauuucauuaac 
5'     uccuc      ccu cu  cucuuccaca            uccucg  caag       gcauc uc                                                               g
       |||||      ||| ||  ||||||||||            ||||||  ||||       ||||| ||                                                                
3'     aggag      gga gg  ggggaggugu            aggggu  guuc       cgugg ag                                                               a
   ---g     caaguu   u  uu          gaaacaguugau      uu    ---gaua     -  uuaccgguuuaaguguuuguuuaggguaucuuuuagaccgucgucccaaauuacugcuacuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 36153447-36153693 [-]
intergenic
Database links

Mature sequence mtr-miR2673a

Accession MIMAT0013493
Sequence

6 - 

ccucuuccucuuccucuuccac

 - 27

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).