Stem-loop sequence mtr-MIR2673b

AccessionMI0012041 (change log)
DescriptionMedicago truncatula miR2673b stem-loop
Gene family MIPF0001017; MIR2673
Stem-loop
   ---------ggugu        -cg uu   -  uc       --u  ---  c  -       -u    aauuuca     a  guuaguuucgauagcgacuucauuuugcauuugugaagcugaauugguccagauuucauuaac 
5'               ugcucuuc   c  ccu cu  cucuucc   cu   uc ac auccucg  caag       gcauc uc                                                               g
                 ||||||||   |  ||| ||  |||||||   ||   || || |||||||  ||||       ||||| ||                                                                
3'               augaggag   g  gga gg  ggggagg   ga   ag ug uaggggu  guuc       cgugg ag                                                               a
   gucugguuaguguu        caa uu   u  uu       ugu  aac  u  a       uu    ---gaua     -  uuaccgguuuaaguguuuguuuaggguaucuuuuagaccgucgucccaaauuacugcuacuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 20465409-20465684 [-]
intergenic
Database links

Mature sequence mtr-miR2673b

Accession MIMAT0013494
Sequence

19 - 

ccucuuccucuuccucuuccac

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).