Stem-loop sequence mtr-MIR2674

AccessionMI0012042 (change log)
DescriptionMedicago truncatula miR2674 stem-loop
Stem-loop
   ---------------------------------------------------------------------------------------------------------------------------------------aauuagaagcucuggcuggaaaacacgaauggu      g  -  ag   a  cau   ca   -    g    aaag  u 
5'                                                                                                                                                                         uuaauc cu ca  ucg au   cau  caa cucg gaca    gu g
                                                                                                                                                                           |||||| || ||  ||| ||   |||  ||| |||| ||||    || c
3'                                                                                                                                                                         aguugg ga gu  agu ua   gua  guu gggu cugu    ca u
   auaaucuuuucacucuuggguacugaagguuucgcucaccuacuggucuccguauacaauguugugcaagauuuuguacguaaaaaagacaacuuuguaaaaacaucgaaccugauuuaaguagaaauuuucgaaaggaagauugguugagucgucguagauacagua      g  a  gg   a  aau   -a   a    a    ---a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 17900754-17901047 [-]
intergenic
Database links

Mature sequence mtr-miR2674

Accession MIMAT0013495
Sequence

256 - 

cacucgcuuuggaagucaugg

 - 276

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).