Stem-loop sequence mtr-MIR2675

AccessionMI0012043 (change log)
DescriptionMedicago truncatula miR2675 stem-loop
Stem-loop
   acuuucau                   a    -  a        uuuaaaaaggucccugcaaaaauuuuuguuuuugaaaauaaaau 
5'         gaauaugguuuuggucccu caaa au uuuuguuu                                            u
           ||||||||||||||||||| |||| || ||||||||                                             
3'         uuuauaccaaaauuaggga guuu ua ggagcaaa                                            u
   ----cgau                   c    a  c        accaaaaucaggaacauuuuuuuuuaaacaaaaaccaggaacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 35808536-35808708 [-]
intergenic
Database links

Mature sequence mtr-miR2675

Accession MIMAT0013496
Sequence

137 - 

cgaggcauauuugcagggauu

 - 157

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).