Stem-loop sequence mtr-MIR2676b

AccessionMI0012046 (change log)
DescriptionMedicago truncatula miR2676b stem-loop
Gene family MIPF0000831; MIR2676
Stem-loop
   c   ug   g  u   aa  ug  ga   u  a   ug      a     ---         -u    aag       -uagagaau       g    cu 
5'  cau  uuu ga aau  uu  aa  auu uc aaa  auggaa uuuau   gaaguauuu  guuc   uuaaaau         uucaaau acac  a
    |||  ||| || |||  ||  ||  ||| || |||  |||||| |||||   |||||||||  ||||   |||||||         ||||||| ||||   
3'  gua  aaa cu uua  aa  uu  uaa ag uuu  uaccuu aagua   uuucauaaa  uaag   aguuuug         agguuug ugug  a
   -   gu   a  u   ag  gu  aa   u  g   gu      -     gaa         cu    -gg       uaaguaagu       -    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2676b

Accession MIMAT0013499
Sequence

156 - 

cauuguuuggauaauaauuug

 - 176

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).