Stem-loop sequence mtr-MIR2676c

AccessionMI0012047 (change log)
DescriptionMedicago truncatula miR2676c stem-loop
Gene family MIPF0000831; MIR2676
Stem-loop
   a   -ua      uuaucauu            --   ug   uu     ccaggccuuugcaauuugcuucauaaacuuugaaguauuguuucauaaaucacauuggaaggcuuauuacuu 
5'  auc   uuggaa        uguuuuaaauua  auu  gau  uggaa                                                                        a
    |||   ||||||        ||||||||||||  |||  |||  |||||                                                                         
3'  uag   aacuuu        acgaaguuuaau  uag  uug  accuu                                                                        a
   g   uaa      -------u            aa   gu   uu     aagugggguuucauaaacuuaagggaauuuuguuauguaagggaguuuuguaaggggguagguuugugugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 880135-880370 [+]
intergenic
Database links

Mature sequence mtr-miR2676c

Accession MIMAT0013500
Sequence

197 - 

cauuguuuggauaauaauuug

 - 217

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).