Stem-loop sequence mtr-MIR2676d

AccessionMI0012048 (change log)
DescriptionMedicago truncatula miR2676d stem-loop
Gene family MIPF0000831; MIR2676
   ------------------------------------------------------------------------------------------------------augauuuguguucaauauagauauaaggacaauggggugauuauacacaugaucauuauuacauaaagauuucgucauaucacauaaca      -  -a     ---gu          u  uau 
5'                                                                                                                                                                                                uuuuug uc  cuuau     ggcaacaaua au   u
                                                                                                                                                                                                  |||||| ||  |||||     |||||||||| ||    
3'                                                                                                                                                                                                aagaac ag  ggaua     uuguuguuau ug   a
   aacuuuuaggaaguuuaauaauagguuuguuacuuuaaguggaguuucauaaacuuaaaggaauuuuguaauguaagggaguuuuguaaggagguagguuugugugagaaucaaaaaaaaccaauuuaaguuaaaacuaggagcauaaaaguuaaaacaauugaaaauuauguugauaaaaauuuuaauug      u  gg     aauuu          u  uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2676d

Accession MIMAT0013501

319 - 


 - 339

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).