Stem-loop sequence mtr-MIR2676f

AccessionMI0012050 (change log)
DescriptionMedicago truncatula miR2676f stem-loop
Gene family MIPF0000831; MIR2676
Stem-loop
   uuuuuuauuacuucauccaaacaauaacauuuaagaaugaaaacaa   aa ug  uc             auaauucuaaauucuucaaaauuucucaauu 
5'                                               uug  u  aa  auuugaauucccu                               a
                                                 |||  |  ||  |||||||||||||                               c
3'                                               agu  g  uu  uaaacuuaaggga                               c
   ------------------gaaguuuaauaauagguuuguuaccuua   gg gu  ua             guuuuguaaaaggaucucacacaaaccuacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 31692186-31692374 [+]
intergenic
Database links

Mature sequence mtr-miR2676f

Accession MIMAT0013503
Sequence

166 - 

cauuguuuggauaauaauuug

 - 186

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).