Stem-loop sequence mtr-MIR2677

AccessionMI0012052 (change log)
DescriptionMedicago truncatula miR2677 stem-loop
Stem-loop
   c    - -----       -ucu      ug  a   c    ag    c    -----      aaaaaaaaauaaaggaaaacacuaauaaauacaauagcuauagcuuugucgucgccuagaguuuacau 
5'  acca c     uaaauau    auuuau  au uug uaau  auuc uauu     aagauu                                                                    g
    |||| |     |||||||    ||||||  || ||| ||||  |||| ||||     ||||||                                                                    a
3'  uggu g     auuuaua    ugaaug  ua aau auua  uaag auaa     uucuaa                                                                    a
   a    u cucca       ucgu      gu  g   u    ag    a    aaugu      aaaaaaauaagauauuggaaaguacugucuuuucccuuuauuuuuuuuuuccuuuaaaaaacauccua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 9566290-9566544 [+]
intergenic
Database links

Mature sequence mtr-miR2677

Accession MIMAT0013505
Sequence

18 - 

uuuauugauauugcuaauagau

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).