Stem-loop sequence mtr-MIR2678

AccessionMI0012053 (change log)
DescriptionMedicago truncatula miR2678 stem-loop
Literature search

1 open access papers mention mtr-MIR2678
(1 sentences)

Stem-loop
   a    --g    ucccaacca           c  uu      gagcuucucuccaucuugacaccaucugagagucuugucggaaucuuuguucauguuuggcaaaagcuucagaauaaaucccacuuugcuuucgaaccucagaaggaucaacaucauagaaaacaagaagaacauguuuuucagauuccucaaugcauucacaaaucuucucua 
5'  ucac   uaga         aagauacucgc ac  guuuua                                                                                                                                                                              a
    ||||   ||||         ||||||||||| ||  ||||||                                                                                                                                                                              u
3'  agug   gucu         uucugugagcg ug  uaaagu                                                                                                                                                                              u
   c    aaa    -----ccac           u  -u      aacuaaaagaaaaacuacggaaacuuuguuuuccauaaaaacauaaagcccuacuauguuuagaaguuuuuccacuuagguaucccggacucgaagaagcucguuagguuccuagaguacaaaaacaacggcagaagaguucuuuaauacgaaggagcuguaccacgaacguuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 19671276-19671704 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2678
mtr-MIR2678chr6: 19671276-19671704 [-]
mtr-MIR2649chr6: 19670625-19670729 [+]
Database links

Mature sequence mtr-miR2678

Accession MIMAT0013506
Sequence

393 - 

ugaaauuguugcgagugucuu

 - 413

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).