Stem-loop sequence mtr-MIR2679a

AccessionMI0012054 (change log)
DescriptionMedicago truncatula miR2679a stem-loop
Gene family MIPF0000892; MIR2679
Stem-loop
   a   c  -u   a   ucauacuuuuc         c        guacuaucacuuuggaa 
5'  ugg gg  ccg aac           acuuucgaa gggugagu                 g
    ||| ||  ||| |||           ||||||||| ||||||||                  
3'  acc cc  ggc uug           uggagguuu uccauucg                 a
   a   u  uc   a   -----uuaacu         -        gcucauuguauaucugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 26916150-26916268 [+]
intergenic
Database links

Mature sequence mtr-miR2679a

Accession MIMAT0013507
Sequence

21 - 

cuuuucacuuucgaacgggug

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).