Stem-loop sequence mtr-MIR2680a

AccessionMI0012057 (change log)
DescriptionMedicago truncatula miR2680a stem-loop
Gene family MIPF0000841; MIR2680
Stem-loop
   a     ucu   ccu   a    uu      -   augcaaaaauauccggauauucccggaggaguuggaugaucuucuguuu 
5'  uaggg   aga   ggc uauc  cauagg acc                                                 a
    |||||   |||   ||| ||||  |||||| |||                                                  
3'  guccu   ucu   ucg auag  guaucc ugg                                                 a
   g     -uc   aac   a    uu      a   cuccuuuuguucgcucuuuaguucuaaccacgaugagaucuccuucccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 33174370-33174537 [-]
intergenic
chr2: 28201914-28202081 [-]
intergenic
chr3: 36082797-36082964 [-]
intergenic
chr7: 4640100-4640267 [-]
intergenic
chr7: 18902202-18902369 [+]
intergenic
AC149807.14: 38188-38355 [+]
intergenic
Database links

Mature sequence mtr-miR2680a

Accession MIMAT0013510
Sequence

130 - 

uccucgguaccuauguugau

 - 149

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).