Stem-loop sequence mtr-MIR2680b

AccessionMI0012058 (change log)
DescriptionMedicago truncatula miR2680b stem-loop
Gene family MIPF0000841; MIR2680
Stem-loop
   a     ucu   c u   a    uu      -   augca      uc  -  uauucccggaggaguuggaugaucuucuguuu 
5'  uaggg   aga c ggc uauc  cauagg acc     aaaaua  ug ga                                a
    |||||   ||| | ||| ||||  |||||| |||     ||||||  || ||                                 
3'  guucu   ucu g ucg auag  guaucc ugg     uuuugu  gc cu                                a
   g     -uc   a c   a    uu      a   -cucc      uc  u  uuaguucuaaccacggugagaucuccuucccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 28991511-28991678 [+]
intergenic
Database links

Mature sequence mtr-miR2680b

Accession MIMAT0013511
Sequence

130 - 

uccucgguaccuauguugau

 - 149

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).