Stem-loop sequence mtr-MIR2680c

AccessionMI0012059 (change log)
DescriptionMedicago truncatula miR2680c stem-loop
Gene family MIPF0000841; MIR2680
Stem-loop
   a     ucu   ccu   a    uu      -   augcaaaaauauccggauauucccggaggagcuggaugaucuucuguuu 
5'  uaggg   aga   ggc uauc  cauagg acc                                                 a
    |||||   |||   ||| ||||  |||||| |||                                                  
3'  guccu   ucu   ucg auag  guaucc ugg                                                 a
   g     -uc   aac   a    uu      a   cuccuuuuguucgcucuuuaguucuaaccacgaugagaucuccuucccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 27957823-27957990 [+]
intergenic
chr2: 27973088-27973255 [+]
intergenic
chr5: 29209287-29209454 [-]
intergenic
chr5: 31594667-31594834 [+]
intergenic
AC140545.26: 120938-121105 [+]
intergenic
Database links

Mature sequence mtr-miR2680c

Accession MIMAT0013512
Sequence

130 - 

uccucgguaccuauguugau

 - 149

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).