Stem-loop sequence mtr-MIR2680d

AccessionMI0012060 (change log)
DescriptionMedicago truncatula miR2680d stem-loop
Gene family MIPF0000841; MIR2680
   a     ucu   ccu   a    uu      -   augcaaaaauauccggauauucccggaggaguuggaugaucuucuguuu 
5'  uaggg   aga   ggc uauc  cauagg acc                                                 a
    |||||   |||   ||| ||||  |||||| |||                                                  
3'  guucu   ucu   ucg auag  guaucc ugg                                                 a
   g     -uc   aac   a    uu      a   cuccuuuuguucgcucuuuaguucuaaccacgaugagaucuccuucccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 6163059-6163226 [+]
Database links

Mature sequence mtr-miR2680d

Accession MIMAT0013513

130 - 


 - 149

Get sequence
Evidence experimental; 454 [1]


PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).