Stem-loop sequence aqc-MIR166e

Accession

MI0012073

Description

Aquilegia caerulea miR166e stem-loop

Gene family

MIPF0000004; MIR166

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Stem-loop

--     a      uu           g c   u   uu     cucuuaauugaaacucaaucuauaaccggu 
  uugag ggaaug  gucugguucga g cac aac  aacaa                              u
  ||||| ||||||  ||||||||||| | ||| |||  |||||                               
  aacuc ccuuac  cggaccaggcu c gug uug  uuguu                              a
uu     c      uu           g u   u   -u     uguggucgcucgcguucgcgaaagugaacg 

Mature sequence aqc-miR166e

• Accession: MIMAT0012555
• Sequence: 121 - ucggaccaggcuucauucccc - 141
• Evidence: not experimental

References

1. PMID:19699282 "Identification of conserved Aquilegia coerulea microRNAs and their targets" Puzey JR, Kramer EM Gene. 448:46-56(2009).