Stem-loop sequence aqc-MIR529

Accession MI0012110
Description Aquilegia caerulea miR529 stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--     u       ------   u           -          -a    u  uc  cu    a 
  agaga gagagau      aug ugacagaagag agagagcaca  ccca ca  ag  aaag g
  ||||| |||||||      ||| ||||||||||| ||||||||||  |||| ||  ||  |||| a
  ucucu cucucua      uac acugucuucuc uuucucgugu  gggu gu  uc  uuuc g
uc     -       aaccac   u           g          ga    u  uu  -u    u 
Get sequence

Mature sequence aqc-miR529

Accession MIMAT0012592
Sequence

22 - 

agaagagagagagcacaaccc

 - 42

Get sequence
Evidence not experimental

References

1