![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-450a-1 |
||||||||||||||||
Accession | MI0012213 (change log) | |||||||||||||||
Previous IDs | bta-mir-450-1 | |||||||||||||||
Description | Bos taurus miR-450a-1 stem-loop | |||||||||||||||
Gene family | MIPF0000128; mir-450 | |||||||||||||||
Literature search |
5 open access papers mention bta-mir-450a-1 | |||||||||||||||
Stem-loop |
----------------- uuu u cag 5' acuau ugcga guguuccuaauaug u ||||| ||||| |||||||||||||| a 3' uggua acguu uacgaggguuauau u gacauauaacuauguuu cgu u aaa |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
|
Mature sequence bta-miR-450a |
|
Accession | MIMAT0003834 |
Previous IDs | bta-miR-450 |
Sequence |
6 - uuuugcgauguguuccuaauau - 27 |
Deep sequencing | 10304 reads, 69 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:19758457
"Characterization of bovine miRNAs by sequencing and bioinformatics analysis"
BMC Mol Biol. 10:90(2009).
|