|
miRBase |
|
Stem-loop sequence hvt-mir-H3 |
|
| Accession | MI0012475 |
| Description | Herpesvirus of turkeys miR-H3 stem-loop |
| Stem-loop |
cug au ga g gg c --g c cguc g uc cg ggga gccgccgc ga c |||| | || || |||| |||||||| || gcgg c ag gc cccu uggcggug cu g cug cu gg - ag - uaa g |
Mature sequence hvt-miR-H3-5p |
|
| Accession | MIMAT0012712 |
| Sequence |
4 - cgucauggaucgcggggggacg - 25 |
| Evidence | experimental; Solexa [1] |
Mature sequence hvt-miR-H3-3p |
|
| Accession | MIMAT0012713 |
| Sequence |
54 - cccgacggaggcucggcg - 71 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:19328516
"MicroRNAs of Gallid and Meleagrid herpesviruses show generally conserved genomic locations and are virus-specific"
Virology. 388:128-136(2009).
|