Stem-loop sequence mdo-mir-429

AccessionMI0012497 (change log)
DescriptionMonodelphis domestica miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -   ug   u -          aa       cucgc 
5'  gau  gug c uuaccagaca  guuagau     u
    |||  ||| | ||||||||||  |||||||      
3'  cug  uac g aauggucugu  uaaucug     a
   a   gu   c u          ca       ucuuu 
Get sequence
Deep sequencing
5364 reads, 50 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 389175425-389175496 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-429
mdo-mir-200bchr4: 389166960-389167027 [+]
mdo-mir-200achr4: 389169611-389169696 [+]
mdo-mir-429chr4: 389175425-389175496 [+]
Database links

Mature sequence mdo-miR-429

Accession MIMAT0012741
Sequence

45 - 

uaauacugucugguaaugcc

 - 64

Get sequence
Deep sequencing5194 reads, 4 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).