Stem-loop sequence mml-mir-665

AccessionMI0012543 (change log)
DescriptionMacaca mulatta miR-665 stem-loop
Gene family MIPF0000404; mir-665
Stem-loop
   -  u   -c          u      -acc  g  c 
5'  uc ccu  gaggggucuc gccucu    ca ga u
    || |||  |||||||||| ||||||    || || c
3'  gg gga  cuccccggag cggagg    gu cu u
   c  c   ca          u      acca  a  u 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163208516-163208587 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-665
mml-mir-493chr7: 163202837-163202925 [+]
mml-mir-337chr7: 163207975-163208067 [+]
mml-mir-665chr7: 163208516-163208587 [+]
mml-mir-431chr7: 163215205-163215318 [+]
mml-mir-433chr7: 163216084-163216176 [+]
mml-mir-127chr7: 163217177-163217273 [+]
Database links

Mature sequence mml-miR-665

Accession MIMAT0012786
Sequence

43 - 

accaggaggcugaggccccu

 - 62

Get sequence
Deep sequencing31 reads, 8 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).