Stem-loop sequence ptr-mir-299

AccessionMI0012563 (change log)
DescriptionPan troglodytes miR-299 stem-loop
Gene family MIPF0000186; mir-299
Literature search

2 open access papers mention ptr-mir-299
(37 sentences)

Stem-loop
   ------     a                      uu 
5'       aagaa ugguuuaccgucccacauacau  u
         ||||| ||||||||||||||||||||||  g
3'       uucuu gccaaauggcaggguguaugua  a
   cuaugg     c                      ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86272294-86272362 [+]
sense
ENSPTRT00000061481 ; ptr-mir-299-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-299
ptr-mir-379chr14: 86270569-86270634 [+]
ptr-mir-411chr14: 86271826-86271920 [+]
ptr-mir-299chr14: 86272294-86272362 [+]
ptr-mir-380chr14: 86273518-86273577 [+]
ptr-mir-1197chr14: 86274065-86274151 [+]
ptr-mir-323chr14: 86274233-86274317 [+]
ptr-mir-758chr14: 86274527-86274613 [+]
ptr-mir-329-1chr14: 86275292-86275370 [+]
ptr-mir-329-2chr14: 86275609-86275687 [+]
ptr-mir-494chr14: 86278152-86278231 [+]
ptr-mir-543chr14: 86280507-86280583 [+]
ptr-mir-495chr14: 86282275-86282355 [+]
Database links

Mature sequence ptr-miR-299

Accession MIMAT0012801
Sequence

7 - 

ugguuuaccgucccacauacau

 - 28

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).