Stem-loop sequence rno-mir-202

AccessionMI0012584 (change log)
DescriptionRattus norvegicus miR-202 stem-loop
Gene family MIPF0000121; mir-202
Literature search

4 open access papers mention rno-mir-202
(6 sentences)

Stem-loop
        u           -a          ug       
5' guucc uuuuccuaugc  uauacuucuu  uggauc 
   ||||| |||||||||||  ||||||||||  ||||| u
3' cgagg aaaaggguacg  auauggagaa  aucugg 
        u           cg          --       
Get sequence
Deep sequencing
28583 reads, 509 reads per million, 79 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 212295630-212295701 [-]
intergenic
Database links

Mature sequence rno-miR-202-5p

Accession MIMAT0012822
Previous IDsrno-miR-202
Sequence

9 - 

uuccuaugcauauacuucu

 - 27

Get sequence
Deep sequencing28308 reads, 77 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-202-3p

Accession MIMAT0017355
Previous IDsrno-miR-202*
Sequence

45 - 

agagguauagcgcaugggaaa

 - 65

Get sequence
Deep sequencing273 reads, 28 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).