Stem-loop sequence rno-mir-105

AccessionMI0012587 (change log)
DescriptionRattus norvegicus miR-105 stem-loop
Gene family MIPF0000074; mir-105
Literature search

6 open access papers mention rno-mir-105
(82 sentences)

Stem-loop
   ----------   u  a                    g ug 
5'           uag ca gugcucagaugucuguggug c  c
             ||| || |||||||||||||||||||| |  u
3'           auc gu uacgaguuuguaggcacuau g  u
   caucuauggu   -  g                    - ua 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 152585531-152585603 [-]
sense
ENSRNOT00000040729 ; Gabra3-201; intron 1
Database links

Mature sequence rno-miR-105

Accession MIMAT0012825
Sequence

5 - 

caagugcucagaugucuguggu

 - 26

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).