Stem-loop sequence rno-mir-592

AccessionMI0012596 (change log)
DescriptionRattus norvegicus miR-592 stem-loop
Gene family MIPF0000340; mir-592
Literature search

4 open access papers mention rno-mir-592
(11 sentences)

Stem-loop
   u   --a     c     ca        a    c        gu    a 
5'  gau   uuaug caugg  uuguguca uaug gaugaugu  ugug u
    |||   ||||| |||||  |||||||| |||| ||||||||  ||||  
3'  cua   aaugc guacu  aacgcagu gugc cuacugcg  acac g
   a   cag     a     ac        g    a        --    g 
Get sequence
Deep sequencing
10927 reads, 1.14 reads per million, 263 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr4: 55182370-55182465 [-]
intergenic
Database links

Mature sequence rno-miR-592

Accession MIMAT0012834
Sequence

18 - 

auugugucaauaugcgaugaugu

 - 40

Get sequence
Deep sequencing10925 reads, 263 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:23971736 "Novel cerebellum-enriched miR-592 may play a role in neural progenitor cell differentiation and neuronal maturation through regulating Lrrc4c and Nfasc in rat" Zhang J, Zhang J, Zhou Y, Wu YJ, Ma L, Wang RJ, Huang SQ, Gao RR, Liu LH, Shao ZH, Shi HJ, Cheng LM, Yu L Curr Mol Med. 13:1432-1445(2013).