Stem-loop sequence rno-mir-628

AccessionMI0012598 (change log)
DescriptionRattus norvegicus miR-628 stem-loop
Gene family MIPF0000529; mir-628
Literature search

2 open access papers mention rno-mir-628
(4 sentences)

Stem-loop
   agcuguugugucgc       u    a   a     g       gcaa 
5'               uuccuca gcug cau uuuac agagggu    u
                 ||||||| |||| ||| ||||| |||||||     
3'               ggggagu ugac gug gaaug ucuucca    u
   -------------u       -    g   a     g       auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr8: 79679458-79679541 [+]
sense
ENSRNOT00000039176 ; Ccpg1-201; intron 5
Database links

Mature sequence rno-miR-628

Accession MIMAT0012836
Sequence

21 - 

augcugacauauuuacgagagg

 - 42

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).