Stem-loop sequence rno-mir-761

AccessionMI0012615 (change log)
DescriptionRattus norvegicus miR-761 stem-loop
Gene family MIPF0000709; mir-761
Literature search

3 open access papers mention rno-mir-761
(8 sentences)

Stem-loop
   u  c  -gu                      g  a  g 
5'  gg aa   ggaggagcagcagggugaaacu ac ca u
    || ||   |||||||||||||||||||||| || ||  
3'  cc uu   ccuccucgucguuucacuuuga ug gu u
   a  c  agu                      g  -  c 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr5: 128651867-128651942 [+]
sense
ENSRNOT00000010440 ; Nrd1-202; intron 2
ENSRNOT00000010462 ; Nrd1-201; 3'UTR (exon 4)
Database links

Mature sequence rno-miR-761

Accession MIMAT0012853
Sequence

15 - 

gcagcagggugaaacugacaca

 - 36

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).