Stem-loop sequence rno-mir-764

AccessionMI0012616 (change log)
DescriptionRattus norvegicus miR-764 stem-loop
Gene family MIPF0000707; mir-764
Literature search

3 open access papers mention rno-mir-764
(10 sentences)

Stem-loop
   u    ac     aa   uc  a     g   u   -   u           ccua 
5'  caac  aauca  auc  gg ggcag ugc cac aug ccuccuccaug    c
    ||||  |||||  |||  || ||||| ||| ||| ||| |||||||||||     
3'  guug  uuagu  uag  cc cuguc acg gug uac ggaggagguac    a
   g    cu     --   ua  a     a   -   a   c           auac 
Get sequence
Deep sequencing
9084 reads, 9.73 reads per million, 113 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 118123251-118123358 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-764
rno-mir-3552chrX: 118121374-118121478 [+]
rno-mir-764chrX: 118123251-118123358 [+]
rno-mir-1912chrX: 118130652-118130739 [+]
Database links

Mature sequence rno-miR-764-5p

Accession MIMAT0012854
Previous IDsrno-miR-764
Sequence

27 - 

ggugcucacauguccuccucca

 - 48

Get sequence
Deep sequencing638 reads, 73 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-764-3p

Accession MIMAT0017370
Previous IDsrno-miR-764*
Sequence

65 - 

gaggaggccauaguggcaacugu

 - 87

Get sequence
Deep sequencing8444 reads, 110 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).