|
miRBase |
|
Mature sequence rno-miR-666-5p |
|
| Accession | MIMAT0012855 |
| Previous IDs | rno-miR-666 |
| Sequence |
19 - agcgggcacggcugugagag - 38 |
| Evidence | experimental; SOLiD [2] |
| Predicted targets |
|
Mature sequence rno-miR-666-3p |
|
| Accession | MIMAT0017371 |
| Previous IDs | rno-miR-666* |
| Sequence |
56 - ggcugcagcgugaucgccugcuc - 78 |
| Evidence | experimental; SOLiD [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
| 2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|