Stem-loop sequence rno-mir-678

AccessionMI0012619 (change log)
DescriptionRattus norvegicus miR-678 stem-loop
Gene family MIPF0000774; mir-678
Literature search

1 open access papers mention rno-mir-678
(1 sentences)

Stem-loop
   gugga    g    g   ag  g      gguau    g    ccg 
5'      cugu gcuu ccg  cc ugcucc     gaga augg   a
        |||| |||| |||  || ||||||     |||| ||||    
3'      gacg ugga ggu  gg acgggg     cucu ugcc   g
   -----    g    -   ca  a      -----    g    cac 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr20: 13212428-13212510 [+]
sense
ENSRNOT00000050531 ; Prmt2-201; exon 11
Database links

Mature sequence rno-miR-678

Accession MIMAT0012857
Sequence

56 - 

gucucggggcaaggacuggagg

 - 77

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).