Stem-loop sequence eca-mir-30c

AccessionMI0012671 (change log)
DescriptionEquus caballus miR-30c stem-loop
Gene family MIPF0000005; mir-30
Literature search

4 open access papers mention eca-mir-30c
(8 sentences)

Stem-loop
   a     cu    ugu u       u   aca         ---g  a 
5'  ccaug  guag   g guaaaca ccu   cucucagcu    ug g
    |||||  ||||   | ||||||| |||   |||||||||    ||  
3'  gguac  cguc   c cauuugu ggg   gagggucgg    ac c
   a     --    uuc u       u   --a         ugga  u 
Get sequence
Deep sequencing
7624 reads, 450 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 17432728-17432816 [-]
sense
ENSECAT00000002155 ; NFYC-201; intron 5
Clustered miRNAs
< 10kb from eca-mir-30c
eca-mir-30echr2: 17435650-17435741 [-]
eca-mir-30cchr2: 17432728-17432816 [-]
Database links

Mature sequence eca-miR-30c

Accession MIMAT0012915
Sequence

17 - 

uguaaacauccuacacucucagc

 - 39

Get sequence
Deep sequencing15006 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).