Stem-loop sequence eca-mir-196b

Accession MI0012693
Description Equus caballus miR-196b stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--     uc      uu       u  c           ucca 
  acugg  ggugau  agguagu uc uguuguuggga    g
  |||||  ||||||  ||||||| || |||||||||||     
  ugacu  ucauua  uccguca ag acgacagcucu    c
gu     --      cu       c  c           cuuu 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
4: 58199179-58199262 [-]
intergenic
Database links

Mature sequence eca-miR-196b

Accession MIMAT0012939
Sequence

15 - 

uagguaguuuccuguuguuggg

 - 36

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).