Stem-loop sequence eca-let-7a

AccessionMI0012731 (change log)
DescriptionEquus caballus let-7a stem-loop
Gene family MIPF0000002; let-7
Literature search

6 open access papers mention eca-let-7a
(13 sentences)

Stem-loop
      uu   g   u             uagaa ua a 
5' agg  gag uag agguuguauaguu     u  c u
   |||  ||| ||| |||||||||||||     |  | c
3' ucc  uuc auc uccgacaugucaa     a  g a
      -u   g   c             --uag gg a 
Get sequence
Deep sequencing
222320 reads, 1.62e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr7: 29543908-29543979 [-]
sense
ENSECAT00000027709 ; eca-let-7a-201; exon 1
Clustered miRNAs
< 10kb from eca-let-7a
eca-mir-100chr7: 29549390-29549444 [-]
eca-let-7achr7: 29543908-29543979 [-]
Database links

Mature sequence eca-let-7a

Accession MIMAT0012979
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing444307 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).