Stem-loop sequence eca-let-7e

AccessionMI0012759 (change log)
DescriptionEquus caballus let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention eca-let-7e
(8 sentences)

Stem-loop
     c   cu   g                u  ----g a  a 
5' cc ggg  gag uaggagguuguauagu ga     g gg c
   || |||  ||| |||||||||||||||| ||     | ||  
3' gg ccc  uuc auccuccggcauauca cu     c cc a
     a   cu   g                -  agagg a  c 
Get sequence
Deep sequencing
128794 reads, 9.65e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr10: 21371067-21371145 [+]
intergenic
Clustered miRNAs
< 10kb from eca-let-7e
eca-mir-99bchr10: 21370890-21370959 [+]
eca-let-7echr10: 21371067-21371145 [+]
eca-mir-125achr10: 21371573-21371640 [+]
Database links

Mature sequence eca-let-7e

Accession MIMAT0013007
Sequence

8 - 

ugagguaggagguuguauaguu

 - 29

Get sequence
Deep sequencing128738 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).