Stem-loop sequence eca-mir-125a

AccessionMI0012760 (change log)
DescriptionEquus caballus miR-125a stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention eca-mir-125a
(1 sentences)

Stem-loop
    ug  uc  ug   c    ua        ----  a 
5' c  gg  cc  aga ccuu  accuguga    gg c
   |  ||  ||  ||| ||||  ||||||||    ||  
3' g  cc  gg  ucu ggag  uggacacu    cc a
    gu  ga  gu   u    --        ggga  u 
Get sequence
Deep sequencing
42807 reads, 2.95e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr10: 21371573-21371640 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-125a
eca-mir-99bchr10: 21370890-21370959 [+]
eca-let-7echr10: 21371067-21371145 [+]
eca-mir-125achr10: 21371573-21371640 [+]
Database links

Mature sequence eca-miR-125a-5p

Accession MIMAT0013008
Sequence

6 - 

ucccugagacccuuuaaccuguga

 - 29

Get sequence
Deep sequencing42777 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-125a-3p

Accession MIMAT0013009
Sequence

44 - 

acaggugagguucuugggagcc

 - 65

Get sequence
Deep sequencing30 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).