Stem-loop sequence eca-mir-99b

AccessionMI0012767 (change log)
DescriptionEquus caballus miR-99b stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Deep sequencing
30373 reads, 2.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr10: 21370890-21370959 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-99b
eca-mir-99bchr10: 21370890-21370959 [+]
eca-let-7echr10: 21371067-21371145 [+]
eca-mir-125achr10: 21371573-21371640 [+]
Database links

Mature sequence eca-miR-99b

Accession MIMAT0013018
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Deep sequencing30240 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).