Stem-loop sequence eca-mir-142

AccessionMI0012771 (change log)
DescriptionEquus caballus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Literature search

2 open access papers mention eca-mir-142
(10 sentences)

Stem-loop
   -ac           a         uaa ag a 
5'    ccauaaaguag aagcacuac   c  c c
      ||||||||||| |||||||||   |  |  
3'    gguauuucauc uuugugaug   g  g u
   gua           c         -ug ga g 
Get sequence
Deep sequencing
5745 reads, 300 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 32583173-32583236 [-]
sense
ENSECAT00000028340 ; eca-mir-142-201; exon 1
Database links

Mature sequence eca-miR-142-5p

Accession MIMAT0013022
Sequence

4 - 

cauaaaguagaaagcacuacu

 - 24

Get sequence
Deep sequencing5485 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-142-3p

Accession MIMAT0013023
Sequence

40 - 

uguaguguuuccuacuuuaugga

 - 62

Get sequence
Deep sequencing260 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).