Stem-loop sequence eca-mir-20a

Accession MI0012835
Description Equus caballus miR-20a stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    c   -a                 g   -  uu 
guag acu  aagugcuuauagugcag uag ug  u
|||| |||  ||||||||||||||||| ||| ||   
cguc uga  uucacgaguauuacguc auc au  a
    a   aa                 -   u  ug 
Get sequence
Genome context
Coordinates (EquCab2) Overlapping transcripts
17: 61792863-61792933 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-20a
eca-mir-17 17: 61792416-61792474 [+]
eca-mir-18a 17: 61792556-61792616 [+]
eca-mir-19a 17: 61792692-61792773 [+]
eca-mir-20a 17: 61792863-61792933 [+]
eca-mir-19b 17: 61793002-61793065 [+]
eca-mir-92a 17: 61793120-61793180 [+]
Database links

Mature sequence eca-miR-20a

Accession MIMAT0013088
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).