Stem-loop sequence eca-mir-128-2

AccessionMI0012838 (change log)
DescriptionEquus caballus miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
         uuc       uag      cu       u 
5' guugga   ggggccg   cacugu  gagaggu u
   ||||||   |||||||   ||||||  |||||||  
3' cgacuu   cucuggc   gugaca  cucuuua a
         uuu       caa      --       c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr18: 19492350-19492419 [+]
sense
ENSECAT00000027934 ; eca-mir-128-2-201; exon 1
ENSECAT00000020996 ; R3HDM1-201; intron 22
ENSECAT00000021039 ; R3HDM1-202; intron 22
Database links

Mature sequence eca-miR-128

Accession MIMAT0013076
Sequence

44 - 

ucacagugaaccggucucuuu

 - 64

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).