Stem-loop eca-mir-412

Accession

MI0012899

Description

Equus caballus eca-mir-412 precursor miRNA

Gene family

MIPF0000192; mir-412

Sequence

378 reads, 57 reads per million, 1 experiments

ggguacaggagggauggucgaccaguuggaaaguaauuguuucuaauguacUUCACCUGGUCCACUAGCCGuccguaccc
((((((.(((.((.((((.((((((.(((..((((((((....)))).))))))).)))))).)))).)).)))))))))

Structure

      a   g  a    c      u   aa    -    u 
ggguac gga gg uggu gaccag ugg  agua auug u
|||||| ||| || |||| |||||| |||  |||| ||||  
cccaug ccu CC AUCA CUGGUC ACU  Ucau uaau u
      -   G  G    C      C   --    g    c 

Annotation confidence Not enough data

Genome context

chr24: 42935784-42935863 [+]

Clustered miRNAs

10 other miRNAs are < 10 kb from eca-mir-412

Mature eca-miR-412

• Accession: MIMAT0013155
• Description: Equus caballus eca-miR-412 mature miRNA
• Sequence: 52 - UUCACCUGGUCCACUAGCCG - 71
• Evidence: not_experimental

References

1. PubMed ID: 19406225
   In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach
   "Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y"
   "Genomics (2009) 94:125-131