Stem-loop sequence eca-let-7c

AccessionMI0012925 (change log)
DescriptionEquus caballus let-7c stem-loop
Gene family MIPF0000002; let-7
Literature search

5 open access papers mention eca-let-7c
(8 sentences)

Stem-loop
   -  uu   g   u             ua  g ua a 
5'  gg  gag uag agguuguaugguu  ga u  c c
    ||  ||| ||| |||||||||||||  || |  | c
3'  cc  uuc auc uccaacaugucaa  uu a  g c
   u  -u   g   u             --  g gg u 
Get sequence
Deep sequencing
209653 reads, 1.55e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr26: 15509722-15509792 [+]
sense
ENSECAT00000028010 ; eca-let-7c-201; exon 1
Clustered miRNAs
< 10kb from eca-let-7c
eca-mir-99a-2chr26: 15508980-15509060 [+]
eca-let-7cchr26: 15509722-15509792 [+]
Database links

Mature sequence eca-let-7c

Accession MIMAT0013181
Sequence

4 - 

ugagguaguagguuguaugguu

 - 25

Get sequence
Deep sequencing209637 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).