Stem-loop sequence eca-mir-98

AccessionMI0012988 (change log)
DescriptionEquus caballus miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   a    uc    -          u                 u    ---------      aggg 
5'  ggau  ugcu caugccaggg gagguaguaaguuguau guug         uggggu    a
    ||||  |||| |||||||||| ||||||||||||||||| ||||         ||||||    u
3'  cuua  acgg gugugguccc uuucaucauucaacaua caau         accccg    u
   a    -u    u          -                 u    agaagauua      gauu 
Get sequence
Deep sequencing
115941 reads, 8.75e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 44776534-44776652 [+]
sense
ENSECAT00000024329 ; HUWE1-202; intron 56
ENSECAT00000024109 ; HUWE1-201; intron 61
Database links

Mature sequence eca-miR-98

Accession MIMAT0013247
Sequence

22 - 

ugagguaguaaguuguauuguu

 - 43

Get sequence
Deep sequencing115906 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).