Stem-loop sequence bta-mir-2886

AccessionMI0013059 (change log)
DescriptionBos taurus miR-2886 stem-loop
Stem-loop
   ccggccuacuuggggcuccg   c    ccgcauacauuagcgccgc 
5'                     agc gcug                   c
                       ||| ||||                    
3'                     ucg cgac                   g
   --------------------   -    uuccacugccgccacgccg 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 38707493-38707567 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2886
bta-mir-2886chr19: 38707493-38707567 [+]
bta-mir-10achr19: 38713901-38714009 [+]
Database links

Mature sequence bta-miR-2886

Accession MIMAT0013844
Sequence

40 - 

agcgccgccggccgcacc

 - 57

Get sequence
Deep sequencing9 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).