Stem-loop sequence bta-mir-2887-1

AccessionMI0013060 (change log)
DescriptionBos taurus miR-2887-1 stem-loop
Gene family MIPF0001042; mir-2887
Literature search

4 open access papers mention bta-mir-2887-1
(5 sentences)

Stem-loop
   c    g -a   g gu    ug     a 
5'  gucg g  ccg g  ccgg  cggag g
    |||| |  ||| |  ||||  |||||  
3'  cggc c  ggc c  ggcc  gcuuc c
   c    g gg   a ag    cu     c 
Get sequence
Deep sequencing
5342 reads, 94.7 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 66499737-66499793 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-2887-1
bta-mir-2904-1chr2: 66499624-66499693 [+]
bta-mir-2887-1chr2: 66499737-66499793 [+]
Database links

Mature sequence bta-miR-2887

Accession MIMAT0013845
Sequence

4 - 

cgggaccgggguccggugcg

 - 23

Get sequence
Deep sequencing846 reads, 68 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).