Stem-loop sequence bta-mir-2892

AccessionMI0013067 (change log)
DescriptionBos taurus miR-2892 stem-loop
Literature search

1 open access papers mention bta-mir-2892
(2 sentences)

Stem-loop
   gu    --a   a    c   --c    cccc -    cccccccc       gu 
5'   ggcg   cgg ggcg gac   cccc    c cccc        cgccccg  c
     ||||   ||| |||| |||   ||||    | ||||        |||||||   
3'   ccgc   gcc ccgc cug   gggg    g gggg        gcggggc  c
   -c    ccc   -    -   aca    ucuc c    accgccca       ag 
Get sequence
Deep sequencing
82 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr12: 81731989-81732092 [-]
intergenic
Database links

Mature sequence bta-miR-2892

Accession MIMAT0013850
Sequence

3 - 

ggcgacggaggcgcgacccccc

 - 24

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).