Stem-loop sequence ssc-mir-128-2

AccessionMI0013094 (change log)
DescriptionSus scrofa miR-128-2 stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --        a          agg      cc    g gag 
5'   gcaguggg aggggggccg   cacugu  gaga u   u
     |||||||| ||||||||||   ||||||  |||| |    
3'   ugucaucc uuucucuggc   gugaca  cucu g   a
   ug        c          caa      --    g acg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 22859191-22859270 [+]
sense
ENSSSCT00000021430 ; ssc-mir-128-2.1-201; exon 1
ENSSSCT00000012305 ; ARPP21-201; intron 18
Database links

Mature sequence ssc-miR-128

Accession MIMAT0002157
Previous IDsssc-miR-128a
Sequence

49 - 

ucacagugaaccggucucuuu

 - 69

Get sequence
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).