Stem-loop sequence ssc-mir-98

AccessionMI0013122 (change log)
DescriptionSus scrofa miR-98 stem-loop
Gene family MIPF0000002; let-7
Literature search

8 open access papers mention ssc-mir-98
(22 sentences)

Stem-loop
   gggu                 u    ---------      aggg 
5'     gagguaguaaguuguau guug         uggggu    a
       ||||||||||||||||| ||||         ||||||    u
3'     uuucaucauucaacaua caau         accccg    u
   ----                 u    agaagauua      gauu 
Get sequence
Deep sequencing
9176 reads, 1.53e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 51800864-51800943 [-]
sense
OTTSUST00000011401 ; HUWE1-001; intron 60
ENSSSCT00000021141 ; ssc-mir-98.1-201; exon 1
ENSSSCT00000032330 ; HUWE1-201; intron 59
ENSSSCT00000013481 ; HUWE1-202; intron 59
ENSSSCT00000035055 ; HUWE1-001; intron 60
Clustered miRNAs
< 10kb from ssc-mir-98
ssc-let-7f-1chrX: 51801728-51801810 [-]
ssc-mir-98chrX: 51800864-51800943 [-]
Database links

Mature sequence ssc-miR-98

Accession MIMAT0013905
Sequence

4 - 

ugagguaguaaguuguauuguu

 - 25

Get sequence
Deep sequencing9175 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).