Stem-loop sequence ssc-mir-142

AccessionMI0013134 (change log)
DescriptionSus scrofa miR-142 stem-loop
Gene family MIPF0000084; mir-142
Literature search

15 open access papers mention ssc-mir-142
(38 sentences)

Stem-loop
   -     g   c           a         uaa ag a 
5'  gugca uca ccauaaaguag aagcacuac   c  c c
    ||||| ||| ||||||||||| |||||||||   |  |  
3'  caugu agu gguauuucauc uuugugaug   g  g u
   u     g   a           c         -ug ga g 
Get sequence
Deep sequencing
5652 reads, 673 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 36203916-36203995 [+]
sense
ENSSSCT00000020733 ; ssc-mir-142.1-201; exon 1
Database links

Mature sequence ssc-miR-142-5p

Accession MIMAT0013919
Previous IDsssc-miR-142
Sequence

12 - 

cauaaaguagaaagcacuacu

 - 32

Get sequence
Deep sequencing2258 reads, 14 experiments
Evidence experimental; Illumina [1,3]

Mature sequence ssc-miR-142-3p

Accession MIMAT0020362
Sequence

48 - 

uguaguguuuccuacuuuaugg

 - 69

Get sequence
Deep sequencing3394 reads, 15 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).